Category: Ubiquitin/Proteasome System
-
The GFP area and the number of nuclei were quantified using the Harmony software (PerkinElmer)
The GFP area and the number of nuclei were quantified using the Harmony software (PerkinElmer). neutralization was markedly shortened from 11.5 Alas2 months with D614G to 5.5 months with BA.5. After breakthrough, we observed a sharp increase of Nabs against Omicron subvariants, followed by a plateau and a sluggish decrease after 56 weeks. In nose…
-
Preparation of antibodies against the new collagen VI chains == The purified recombinant collagen VI fragments were used to immunize rabbits and guinea pigs
Preparation of antibodies against the new collagen VI chains == The purified recombinant collagen VI fragments were used to immunize rabbits and guinea pigs. mainly accumulated into the cytoplasm of a sub-set of desmin negative cells, likely of interstitial origin, which can be considered myofibroblasts as they expressed -smooth muscle actin. TGF-1 treatment, a pro-fibrotic…
-
RNA was changed into cDNA by iScript Change Transcriptase Supermix (Biorad, #1708841) and detected using Sybr Green (Thermo, 4309155) program with primers particular for ZIKV E-protein (F: CCGCTGCCCAACACAAG, R: CCACTAACGTTCTTTTGCAGACAT) adapted from a previous publication [37]
RNA was changed into cDNA by iScript Change Transcriptase Supermix (Biorad, #1708841) and detected using Sybr Green (Thermo, 4309155) program with primers particular for ZIKV E-protein (F: CCGCTGCCCAACACAAG, R: CCACTAACGTTCTTTTGCAGACAT) adapted from a previous publication [37]. of map B-factor and quality in ZIKV-E/G9E Fab organic framework. (A) Consultant electron denseness map of G9E Fab/ZIKV E…